Sequence ID | >SRA1018621 |
Genome ID | SRR035082.323928 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 79 |
End posion on genome | 151 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gctcagttat |
tRNA gene sequence |
GCGGGTATGGTATAATGGTTATTATCTCAGTTTTCCAAACTGATGATACGGGTTCGATTC |
Downstream region at tRNA end position |
gaactcttga |
Secondary structure (Cloverleaf model) | >SRA1018621 Gly TCC t TCtg gaactcttga G - C C - G G - C G - C G - C T - A A - T T T T T G C C C A T A A G | | | | | G G T A T G A C G G G C G | | + T T T T T A T T A C TGAT T - A C - G A - T G - C T - A T A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |