| Sequence ID | >SRA1018638 |
| Genome ID | SRR035082.326296 |
| Phylum/Class | 454 Sequencing (SRP001803) |
| Species | |
| Start position on genome | 319 |
| End posion on genome | 246 |
| Amino Acid | Val |
| Anticodon | CAC |
| Upstream region at tRNA start position |
gttttcatga |
| tRNA gene sequence |
GGGCAATTAGCTCAGTTGGTTAGAGCGCTTGCTTCACACGCAAGAGGTCAGTGGTTCGAA |
| Downstream region at tRNA end position |
cctcaccagc |
| Secondary structure (Cloverleaf model) | >SRA1018638 Val CAC
a Anac cctcaccagc
G - C
G - C
G - C
C - G
A - T
A - T
T - A T A
T T C A C C A
T G A A | | | | | G
T C T C G A G T G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
T - A
T - A
G - C
C - G
T C
T A
C A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |