Sequence ID | >SRA1018648 |
Genome ID | SRR035082.327786 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 293 |
End posion on genome | 219 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
accagaccat |
tRNA gene sequence |
CGGGGCGTAGCTCAGCTTGGTAGAGCGCCCGCTTTGGGAGCGGGAAGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
agaccaccat |
Secondary structure (Cloverleaf model) | >SRA1018648 Pro TGG t ACgg agaccaccat C - G G - C G - C G - C G - C C - G G - C T A T T G T C C A C G A A + | | | | G T C T C G G C A G G C T | | | | T T G G A G C G T A G AAGTC C - G C - G C - G G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |