Sequence ID | >SRA1018817 |
Genome ID | SRR035082.351971 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 221 |
End posion on genome | 137 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aacaaaatga |
tRNA gene sequence |
GCGCGGGTGCTGTAACTGGTAGCCAGGCTAGCTTGAGGTGCTAGTGTCCTTATGGACGTG |
Downstream region at tRNA end position |
ccagccaggc |
Secondary structure (Cloverleaf model) | >SRA1018817 Leu GAG a ACat ccagccaggc G - C C - G G - C C - G G - C G - C G - C T G T T C T C C A C A A G + | | | | G T T G T C G G A G G C G | | | T T G C C A G T A G G TGTCCTTATGGACGT C - G T - A A - T G - C C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |