| Sequence ID | >SRA1018878 |
| Genome ID | SRR035082.362329 |
| Phylum/Class | 454 Sequencing (SRP001803) |
| Species | |
| Start position on genome | 382 |
| End posion on genome | 308 |
| Amino Acid | Asp |
| Anticodon | GTC |
| Upstream region at tRNA start position |
cccccctacg |
| tRNA gene sequence |
GGGAATATAGATCAGTGGCAGATCGCTACATTGTCAATGTAGAAGTCGTGGGTTCGAACC |
| Downstream region at tRNA end position |
aggtatgaag |
| Secondary structure (Cloverleaf model) | >SRA1018878 Asp GTC
g GCTA aggtatgaag
G - C
G - C
G - C
A - T
A - T
T - A
A - T C A
T C A C C C A
G A A | | | | | G
T C T A G G T G G G C
G | | | | T T
G G A T C
C A G AAGTC
C - G
T - A
A - T
C - G
A - T
T A
T A
G T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |