Sequence ID | >SRA1018898 |
Genome ID | SRR035082.366489 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 7 |
End posion on genome | 80 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
nnnnaaaaat |
tRNA gene sequence |
AGGGGCATAGGCTAATGGTAAACTTCTTCTCTCCAAAAGAAGAGTTGCAGGTTCGAGTCC |
Downstream region at tRNA end position |
acattgacta |
Secondary structure (Cloverleaf model) | >SRA1018898 Trp CCA t GCAA acattgacta A - T G - C G - C G - C G - C C - G A - T T G T C G T C C A A A A | | | | | G T T C G G G C A G G C G | | + T T G A A C T T A T AGTT C - G T - A T - A C - G T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |