| Sequence ID | >SRA1018945 |
| Genome ID | SRR035082.374313 |
| Phylum/Class | 454 Sequencing (SRP001803) |
| Species | |
| Start position on genome | 79 |
| End posion on genome | 161 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
taaataattc |
| tRNA gene sequence |
GGGCGTGTGGCGGAACTGGCAGACGCGTAAGGTTTAGGACCTTATGCCGAAAGGCGTGTG |
| Downstream region at tRNA end position |
aaacaataag |
| Secondary structure (Cloverleaf model) | >SRA1018945 Leu TAG
c ACtg aaacaataag
G - C
G - C
G - C
C - G
G - C
T T
G - C T A
T C A C C C A
C A A G | | | | | G
T G G C G G T G G G C
G | | | T T
G A C G C
C A G G TGCCGAAAGGCGT
T - A
A - T
A - T
G - C
G - C
T A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |