Sequence ID | >SRA1018994 |
Genome ID | SRR035082.383398 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 126 |
End posion on genome | 200 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
gtttttacgT |
tRNA gene sequence |
AGCCCCATAGTACAGTGGTCAAGTATGATTGGTTCTGGGCCAATTGACCCAGGTTCGAAT |
Downstream region at tRNA end position |
attcgaaccg |
Secondary structure (Cloverleaf model) | >SRA1018994 Gln CTG T ATta attcgaaccg A - T G - C C - G C - G C - G C - G A - T T A T G G T C C A T G A A | | | | | G G C A T G C C A G G C G | | | + T T T G T A T C A A G TGAC A - T T - A T - A G - C G - C T G T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |