Sequence ID | >SRA1019024 |
Genome ID | SRR035082.387331 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 294 |
End posion on genome | 366 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
tactaaagac |
tRNA gene sequence |
GCCCTCATAGCTCAAAGGNTAGAGTACTGGTTTCCGGAACCAGTGATCGAGGTTCAAGTC |
Downstream region at tRNA end position |
aggcatctta |
Secondary structure (Cloverleaf model) | >SRA1019024 Arg CCG c ACat aggcatctta G - C C - G C - G C - G T - A C - G A - T T G T G C T C C A A A A A | | | | | A G C T C G C G A G G C G | | | + T T N G A G T T A A TGAT C - G T - A G - C G - C T - A T A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |