| Sequence ID | >SRA1019055 |
| Genome ID | SRR035082.392497 |
| Phylum/Class | 454 Sequencing (SRP001803) |
| Species | |
| Start position on genome | 261 |
| End posion on genome | 186 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
aaaaatgaaa |
| tRNA gene sequence |
CGGGGTGTAGCTCAGTTGGTAGAGCGCGCGGTTTGGGACCGTGAGGTCGTGAGTTCGAAT |
| Downstream region at tRNA end position |
aacttgactt |
| Secondary structure (Cloverleaf model) | >SRA1019055 Pro TGG
a ACAA aacttgactt
C - G
G - C
G - C
G - C
G - C
T - A
G - C T A
T C G C T C A
T G A A | + | | | G
T C T C G G T G A G C
G | | | | T T
G G A G C
T A G AGGTC
C - G
G + T
C - G
G - C
G - C
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |