Sequence ID | >SRA1019117 |
Genome ID | SRR035082.405122 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 42 |
End posion on genome | 112 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
ggtggcttag |
tRNA gene sequence |
TGGCCTGTAGTATAATGGTATTACATTTCGTTTGCAACGAGAAGACTTGGGTTCGATTCC |
Downstream region at tRNA end position |
gaggtatagt |
Secondary structure (Cloverleaf model) | >SRA1019117 Ala TGC g Atta gaggtatagt T - A G - C G + T C - G C - G T - A G - C T T T G A C C C A A A A + | | | | G T T A T G T T G G G C G | | | T T G T T A C T A A AGAC T - A T + G T - A C - G G - C T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |