| Sequence ID | >SRA1019616 |
| Genome ID | SRR035082.490174 |
| Phylum/Class | 454 Sequencing (SRP001803) |
| Species | |
| Start position on genome | 57 |
| End posion on genome | 133 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
ttacagtatt |
| tRNA gene sequence |
CGGGGCGTGGCGCAGTCTGGTAGCGCACCTGCTTTGGGAGCAGGGAGTCGAAGGTTCAAA |
| Downstream region at tRNA end position |
gccttcactt |
| Secondary structure (Cloverleaf model) | >SRA1019616 Pro TGG
t ACCA gccttcactt
C - G
G - C
G - C
G - C
G - C
C - G
G - C T A
T T T T C C A
T G A G + | | | | A
C C G C G G A A G G C
T | | | | T T
G G C G C
G T A A GAGTC
C - G
C - G
T - A
G - C
C - G
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |