Sequence ID | >SRA1019742 |
Genome ID | SRR035082.516341 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 310 |
End posion on genome | 382 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
aaattcaaaT |
tRNA gene sequence |
AGGCCCATAAGCTAGTGGTAAACTGACTCGCTTACACCGAGTATTCATGGGTTCGATCCC |
Downstream region at tRNA end position |
tttacgatag |
Secondary structure (Cloverleaf model) | >SRA1019742 Val TAC T ATtg tttacgatag A - T G - C G - C C - G C - G C - G A - T C T T T A C C C A G A A | | | | | G T T C G A A T G G G C G | | | T T G A A C T T A G ATTC A - T C - G T - A C - G G - C C C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |