Sequence ID | >SRA1019757 |
Genome ID | SRR035082.520986 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001803) |
Species | |
Start position on genome | 70 |
End posion on genome | 145 |
Amino Acid | Ala |
Anticodon | TGC |
Upstream region at tRNA start position |
tgtttgttta |
tRNA gene sequence |
GGGCCGTTAGCTCAATTGGCAGAGCGCCTCGTTTGCAACGAGGAGGTAAGGAGTTCGAAT |
Downstream region at tRNA end position |
ggcgaaaaaa |
Secondary structure (Cloverleaf model) | >SRA1019757 Ala TGC a ACGA ggcgaaaaaa G - C G - C G + T C - G C - G G - C T - A T A T T C C T C A T A A A | | | | | G T C T C G A G G A G C G | | | | T T G G A G C C A G AGGTA C - G C - G T - A C - G G - C T A T A T G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |