Sequence ID | >C151030448 |
Genome ID | CP007630 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Brucella canis SVA13 [CP007629, CP007630] |
Start position on genome | 1103839 |
End posion on genome | 1103763 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
gtcggtatct |
tRNA gene sequence |
GGGCTTGTAGCTCAGTTGGTTAGAGCACACGCTTGATAAGCGTGGGGTCGGAGGTTCAAG |
Downstream region at tRNA end position |
agttacttga |
Secondary structure (Cloverleaf model) | >C151030448 Ile GAT t ACCA agttacttga G - C G - C G - C C - G T + G T - A G - C T G T C C T C C A T G A A | | | | | A T C T C G G G A G G C G | | | | T T G G A G C T T A A GGGTC C - G A - T C - G G - C C - G T A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |