Sequence ID | >C151032356 |
Genome ID | CP007696 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Brucella suis bv. 2 Bs143CITA [CP007695, CP007696] |
Start position on genome | 1014224 |
End posion on genome | 1014313 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
caaggcagac |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGTTGAAGGCGCACGCCTGGAACGCGTGTATACGGGAAACCGTA |
Downstream region at tRNA end position |
taattctcaa |
Secondary structure (Cloverleaf model) | >C151032356 Ser GGA c GCCA taattctcaa G - C G - C A - T G - C A - T G - C G + T T A T C T C C C A T G A G | | | | | G G G C C G G A G G G C G | | | T T T A G G C T G A G TATACGGGAAACCGTATC C - G A - T C - G G - C C - G C C T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |