Sequence ID | >SRA1020672 |
Genome ID | SRR035083.150614 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001804) |
Species | |
Start position on genome | 375 |
End posion on genome | 302 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
cggattggtt |
tRNA gene sequence |
GAGAATATAGCTCAGTTGGTAGAGCATCTGCCTTTTAAGCAGAGGGTCGAAGGTTCGAGC |
Downstream region at tRNA end position |
tgttcaatgc |
Secondary structure (Cloverleaf model) | >SRA1020672 Lys TTT t ACac tgttcaatgc G - C A - T G - C A - T A - T T - A A - T C G T C T T C C A T G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C T A A GGGTC T - A C - G T - A G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |