Sequence ID | >C151036039 |
Genome ID | CP008713 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Candidatus Arthromitus sp. SFB-mouse-NL [CP008713] |
Start position on genome | 1353906 |
End posion on genome | 1353831 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
atggtaatct |
tRNA gene sequence |
AGGGGTATAGCTCAATTGGTAGAGTAGCGGTCTCCAAAACCGTTGGTTGCGGGTTCGACT |
Downstream region at tRNA end position |
tattgtgaaa |
Secondary structure (Cloverleaf model) | >C151036039 Trp CCA t GCCA tattgtgaaa A - T G - C G - C G - C G - C T - A A - T T C T C G T C C A T A A A | | + | | G T C T C G G C G G G C G | | | + T T G G A G T T A A TGGTT G + T C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |