| Sequence ID | >SRA1020711 |
| Genome ID | SRR035083.154464 |
| Phylum/Class | 454 Sequencing (SRP001804) |
| Species | |
| Start position on genome | 260 |
| End posion on genome | 333 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
atgcaaccag |
| tRNA gene sequence |
GGGCCTGTAGCTCAGTTGGTTAGAGCGCGCGCCTGATAAGCGCGAGGTCACAAGTTCAAC |
| Downstream region at tRNA end position |
tgacatagtt |
| Secondary structure (Cloverleaf model) | >SRA1020711 Ile GAT
g Attg tgacatagtt
G - C
G - C
G - C
C - G
C - G
T - A
G - C T C
T T G T T C A
T G A A | | | | | A
T C T C G A C A A G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
G - C
C - G
G - C
C - G
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |