| Sequence ID | >SRA1020734 |
| Genome ID | SRR035083.157200 |
| Phylum/Class | 454 Sequencing (SRP001804) |
| Species | |
| Start position on genome | 260 |
| End posion on genome | 333 |
| Amino Acid | Thr |
| Anticodon | TGT |
| Upstream region at tRNA start position |
gtactgagct |
| tRNA gene sequence |
GCTGGTGTAGCTCAATTGGTAGAGCAGCTGATTTGTAATCAGCAGGTTGCGGGTTCGAGT |
| Downstream region at tRNA end position |
aacgattgcg |
| Secondary structure (Cloverleaf model) | >SRA1020734 Thr TGT
t TCtg aacgattgcg
G - C
C - G
T - A
G - C
G - C
T - A
G - C T G
T T A C C C A
T A A A + | | | G
T C T C G G C G G G C
G | | | | T T
G G A G C
T A A AGGTT
G - C
C - G
T - A
G - C
A - T
T A
T A
T G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |