Sequence ID | >SRA1020887 |
Genome ID | SRR035083.179187 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001804) |
Species | |
Start position on genome | 101 |
End posion on genome | 186 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ctttcttaaT |
tRNA gene sequence |
GAGGGAATGCCGGAGTGGTCAAACGGGCTACGTTTAGGCCGTAGTGGTTTATTCCTACGG |
Downstream region at tRNA end position |
ttgaacgtcc |
Secondary structure (Cloverleaf model) | >SRA1020887 Leu TAG T ATCt ttgaacgtcc G - C A - T G - C G - C G - C A - T A - T T A T C C T C C A T G A G | | + | | A G G G C C G G G G G C G | | | T T T A C G G C A A G TGGTTTATTCCTAC C - G T - A A - T C - G G - C T C T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |