Sequence ID | >C151039105 |
Genome ID | CP008884 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Dyella japonica A8 [CP008884] |
Start position on genome | 3467972 |
End posion on genome | 3467896 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gattcgaaat |
tRNA gene sequence |
CGGGGTATAGCTCAGCCTGGTAGAGCGCCAGCTTTGGGAGCTGGATGTCGGGGGTTCGAA |
Downstream region at tRNA end position |
tgcagatgct |
Secondary structure (Cloverleaf model) | >C151039105 Pro TGG t ACCA tgcagatgct C - G G - C G - C G - C G - C T + G A - T T A T C T C C C A C G A A | + | | | G C C T C G G G G G G C T | | | | T T G G A G C G T A G ATGTC C - G C - G A - T G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |