| Sequence ID | >SRA1021092 |
| Genome ID | SRR035083.207098 |
| Phylum/Class | 454 Sequencing (SRP001804) |
| Species | |
| Start position on genome | 298 |
| End posion on genome | 222 |
| Amino Acid | Gly |
| Anticodon | CCC |
| Upstream region at tRNA start position |
accaccagaA |
| tRNA gene sequence |
GCGGGTGTAACTCAGTTGGTAGAGTGTTTGCTTCCCAAGCAAAATGTCGCGAGTTCGAAT |
| Downstream region at tRNA end position |
ctatcaggac |
| Secondary structure (Cloverleaf model) | >SRA1021092 Gly CCC
A TCCC ctatcaggac
G - C
C - G
G - C
G - C
G - C
T - A
G - C T A
T T G C T C A
T G A A + | | | | G
T C T C A G C G A G C
G | | | | T T
G G A G T
T A G ATGTC
T - A
T - A
T - A
G - C
C - G
T A
T A
C C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |