Sequence ID | >SRA1021274 |
Genome ID | SRR035083.234372 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001804) |
Species | |
Start position on genome | 426 |
End posion on genome | 352 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ataataactg |
tRNA gene sequence |
GTGACTGTAGCTCAATGGTAGAGCGCTAGCCTGTGAAGCTGGATGCTGCGGGTTCAAATC |
Downstream region at tRNA end position |
aattcagtgt |
Secondary structure (Cloverleaf model) | >SRA1021274 His GTG g CCCA aattcagtgt G - C T - A G - C A - T C - G T - A G - C T A T T G C C C A A A A + | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A G ATGCT C - G T + G A - T G - C C - G C A T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |