Sequence ID | >C151042129 |
Genome ID | CP009042 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Vibrio cholerae O1 biovar El Tor FJ147 [CP009041, CP009042] |
Start position on genome | 3021629 |
End posion on genome | 3021555 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
agaagttaat |
tRNA gene sequence |
GGGTCGTTAGCTCAGTGGTAGAGCAGTTGGCTTTTAACCAATTGGTCATAGGTTCAAATC |
Downstream region at tRNA end position |
tttccttcct |
Secondary structure (Cloverleaf model) | >C151042129 Lys TTT t ACCA tttccttcct G - C G - C G - C T - A C - G G - C T - A T A T T A T C C A G A A | | | | | A T C T C G A T A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C G - C C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |