Sequence ID | >C151042163 |
Genome ID | CP009043 |
Search identical group | |
Phylum/Class | Campylobacterota |
Species | Campylobacter iguaniorum 1485E [CP009043] |
Start position on genome | 708553 |
End posion on genome | 708628 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ccattttttt |
tRNA gene sequence |
GTCTCGCTAGCTCAGTCGGTAGAGCATCTCCCTTTTAAGGAGGGGGCCGTTGGTTCGAAT |
Downstream region at tRNA end position |
ctatattgtc |
Secondary structure (Cloverleaf model) | >C151042163 Lys TTT t ACCA ctatattgtc G - C T - A C - G T + G C - G G - C C - G T A T C A A C C A T G A A | | | | | G C C T C G G T T G G C G | | | | T T G G A G C T A A GGGCC T + G C - G T - A C - G C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |