Sequence ID | >SRA1021316 |
Genome ID | SRR035083.241461 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001804) |
Species | |
Start position on genome | 160 |
End posion on genome | 235 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ttccgctcca |
tRNA gene sequence |
GCGAACGTAGCTCAATTGGTAGAGCATCTCGTTGCCAACGAGAAGGTTGTGAGTTCAAGT |
Downstream region at tRNA end position |
tacttctacg |
Secondary structure (Cloverleaf model) | >SRA1021316 Gly GCC a TCCA tacttctacg G - C C - G G - C A - T A - T C - G G - C T G T T A C T C A T A A A + | | | | A T C T C G G T G A G C G | | | | T T G G A G C T A A AGGTT T - A C - G T - A C - G G - C T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |