Sequence ID | >SRA1021444 |
Genome ID | SRR035083.259734 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001804) |
Species | |
Start position on genome | 89 |
End posion on genome | 12 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gaacacttaG |
tRNA gene sequence |
GCCACCTTAGCTCAGCTGGTAGAGCAACTGTTTCGTAAATAGTAGGTCGTGGGTTCGATT |
Downstream region at tRNA end position |
Acctcccttc |
Secondary structure (Cloverleaf model) | >SRA1021444 Thr CGT G TCCC Acctcccttc G - C C - G C - G A - T C - G C - G T - A T T T C T C C C A C G A A | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G + T T - A T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |