Sequence ID | >SRA1021502 |
Genome ID | SRR035083.266577 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001804) |
Species | |
Start position on genome | 332 |
End posion on genome | 407 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
aatctgttgg |
tRNA gene sequence |
GCTCTCGTAGTTCAGCTGGATAGAACGAGGGCCTCCTAAGCCTTAAACAGAGGTTCGAAT |
Downstream region at tRNA end position |
ttgctaatat |
Secondary structure (Cloverleaf model) | >SRA1021502 Arg CCT g ACAA ttgctaatat G - C C - G T - A C - G T - A C - G G - C T A T T C T C C A C G A A | | | | | G T C T T G A G A G G C G | | | | T T G G A A C A T A G AAAC A - T G + T G - C G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |