Sequence ID | >SRA1021621 |
Genome ID | SRR035083.283381 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001804) |
Species | |
Start position on genome | 401 |
End posion on genome | 325 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
accaccagaA |
tRNA gene sequence |
GCGGGTGTAACTCAGTTGGTAGAGTGTTTGCTTCCCAAGCAAAATGTCGCGAGTTCGAAT |
Downstream region at tRNA end position |
ctatcaggaa |
Secondary structure (Cloverleaf model) | >SRA1021621 Gly CCC A TCCC ctatcaggaa G - C C - G G - C G - C G - C T - A G - C T A T T G C T C A T G A A + | | | | G T C T C A G C G A G C G | | | | T T G G A G T T A G ATGTC T - A T - A T - A G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |