| Sequence ID | >SRA1021647 |
| Genome ID | SRR035083.287193 |
| Phylum/Class | 454 Sequencing (SRP001804) |
| Species | |
| Start position on genome | 47 |
| End posion on genome | 129 |
| Amino Acid | Leu |
| Anticodon | TAG |
| Upstream region at tRNA start position |
tcattccact |
| tRNA gene sequence |
GCGAGAGTGGTGAAATTGGTATACACGCTAGTCTTAGGAACTAGTGCCGTGAGGCGTGAG |
| Downstream region at tRNA end position |
ccccaggaaa |
| Secondary structure (Cloverleaf model) | >SRA1021647 Leu TAG
t ACtc ccccaggaaa
G - C
C - G
G - C
A - T
G - C
A - T
G - C T T
T T T C C C A
T A A G + | | | | G
T A G T G G A G G G C
G | | | T T
G A C A C
T A T G TGCCGTGAGGCGT
C - G
T - A
A - T
G - C
T - A
C A
T G
T A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |