| Sequence ID | >SRA1021697 |
| Genome ID | SRR035083.293966 |
| Phylum/Class | 454 Sequencing (SRP001804) |
| Species | |
| Start position on genome | 60 |
| End posion on genome | 133 |
| Amino Acid | Pro |
| Anticodon | TGG |
| Upstream region at tRNA start position |
ttgtacggga |
| tRNA gene sequence |
CGGGGCATGGCGCAGCTGGTAGCGTGCCTGCTTTGGGAGCAGGAGGTCCCGAGTTCGAGT |
| Downstream region at tRNA end position |
ggaatgagcc |
| Secondary structure (Cloverleaf model) | >SRA1021697 Pro TGG
a ACat ggaatgagcc
C - G
G - C
G - C
G - C
G - C
C - G
A - T T G
T G G C T C A
C G A G | | | | | G
T C G C G C C G A G C
G | | | + T T
G G C G T
T A G AGGTC
C - G
C - G
T - A
G - C
C - G
T A
T G
T G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |