Sequence ID | >C151047049 |
Genome ID | CP009267 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Clostridium pasteurianum DSM 525 = ATCC 6013 [CP009267] |
Start position on genome | 4236698 |
End posion on genome | 4236624 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
aaattaataa |
tRNA gene sequence |
GGCCCCTTGGTCAAGCGGTTAAGACACCACCCTTTCACGGTGGTAACATGGGTTCAAGTC |
Downstream region at tRNA end position |
ttttgtgggc |
Secondary structure (Cloverleaf model) | >C151047049 Glu TTC a ACCA ttttgtgggc G - C G + T C - G C - G C - G C - G T - A T G T T G C C C A C G A G | + | | | A G A C T G A T G G G C G | | | T T T A G A C T A A TAAC C - G C - G A - T C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |