Sequence ID | >SRA1022382 |
Genome ID | SRR035083.398526 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001804) |
Species | |
Start position on genome | 294 |
End posion on genome | 367 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ttgtacggga |
tRNA gene sequence |
CGGGGCATGGCGCAGCTGGTAGCGTGCCTGCTTTGGGAGCAGGAGGTCCCGAGTTCGAGT |
Downstream region at tRNA end position |
ggaatgagcc |
Secondary structure (Cloverleaf model) | >SRA1022382 Pro TGG a ACat ggaatgagcc C - G G - C G - C G - C G - C C - G A - T T G T G G C T C A C G A G | | | | | G T C G C G C C G A G C G | | | + T T G G C G T T A G AGGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |