Sequence ID | >C151052978 |
Genome ID | CP009496 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Mycolicibacterium smegmatis INHR2 [CP009496] |
Start position on genome | 6221150 |
End posion on genome | 6221077 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
gcacgggcac |
tRNA gene sequence |
GCCGCCTTAGCTCAGTCGGTAGAGCGATTCACTCGTAATGAATAGGTCGGGGGTTCGATT |
Downstream region at tRNA end position |
tttccttcgc |
Secondary structure (Cloverleaf model) | >C151052978 Thr CGT c TCtc tttccttcgc G - C C - G C - G G - C C - G C - G T - A T T T C C C C C A T G A A | | | | | G C C T C G G G G G G C G | | | | T T G G A G C T A G AGGTC A - T T - A T - A C - G A - T C A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |