Sequence ID | >C151053002 |
Genome ID | CP009498 |
Search identical group | |
Phylum/Class | Elusimicrobiota |
Species | Endomicrobium proavitum Rsa215 [CP009498] |
Start position on genome | 231620 |
End posion on genome | 231695 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ggtaattcgg |
tRNA gene sequence |
GGGGTCGTGGTGTAGCCTGGTTTAACACACTGCCCTGTCAAGGCAGAGATCACGGGTTCA |
Downstream region at tRNA end position |
ttacttcgtt |
Secondary structure (Cloverleaf model) | >C151053002 Asp GTC g Gttt ttacttcgtt G - C G - C G - C G - C T - A C - G G - C T A T C G C C C A C C G A G | | | | A T T G T G A C G G G C G | | | | T T G A C A C T T T A A AGATC C - G T - A G - C C - G C - G C A T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |