Sequence ID | >C151053015 |
Genome ID | CP009498 |
Search identical group | |
Phylum/Class | Elusimicrobiota |
Species | Endomicrobium proavitum Rsa215 [CP009498] |
Start position on genome | 1061723 |
End posion on genome | 1061806 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
acacagcaaT |
tRNA gene sequence |
GCGGCGGTGGCGGAATGGCAGACGCGCAGGTCTCAGAAGCCTGTCCCGAAAGGTGGTGCG |
Downstream region at tRNA end position |
aaaaaacaat |
Secondary structure (Cloverleaf model) | >C151053015 Leu CAG T ATaa aaaaaacaat G - C C - G G - C G - C C - G G - C G - C T A T C G C C C A T A A G | | | | | A G G G C G G C G G G C G | | | T T C A C G C A G G TCCCGAAAGGTGGT C - G A - T G - C G - C T + G C A T A C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |