Sequence ID | >C151053032 |
Genome ID | CP009498 |
Search identical group | |
Phylum/Class | Elusimicrobiota |
Species | Endomicrobium proavitum Rsa215 [CP009498] |
Start position on genome | 964542 |
End posion on genome | 964471 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
cgctgttact |
tRNA gene sequence |
GCCGAGGTGGCTCAGTGGTAGAGCACCTCCTTGGTAAGGAGGTGGTCGCGGGTTCAATTC |
Downstream region at tRNA end position |
attcagatat |
Secondary structure (Cloverleaf model) | >C151053032 Thr GGT t Tttc attcagatat G - C C - G C - G G - C A - T G - C G - C T T T C G C C C A G A G | | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A A TGGTC C - G C - G T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |