Sequence ID | >SRA1022542 |
Genome ID | SRR035083.422239 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001804) |
Species | |
Start position on genome | 399 |
End posion on genome | 326 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ttattggaac |
tRNA gene sequence |
ACGTCAGTAGCTTAATTGGTAGAGCAGCGGTCTCCAAAACCGCAGGTTGGGGGTTCGAGT |
Downstream region at tRNA end position |
agcggagatt |
Secondary structure (Cloverleaf model) | >SRA1022542 Trp CCA c GCtg agcggagatt A - T C - G G - C T - A C - G A - T G - C T G T C T C C C A T A A A | + | | | G T T T C G G G G G G C G + | | | T T G G A G C T A A AGGTT G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |