| Sequence ID | >SRA1022755 |
| Genome ID | SRR035083.454326 |
| Phylum/Class | 454 Sequencing (SRP001804) |
| Species | |
| Start position on genome | 170 |
| End posion on genome | 257 |
| Amino Acid | Ser |
| Anticodon | CGA |
| Upstream region at tRNA start position |
aaagcacccc |
| tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTTGAATGTGGCGGTCTCGAAAACCGTTGTGCGCGCAAGTGCA |
| Downstream region at tRNA end position |
acaaaacaaa |
| Secondary structure (Cloverleaf model) | >SRA1022755 Ser CGA
c GCag acaaaacaaa
G - C
G - C
A - T
G - C
A - T
G - C
G - C T A
T C T C C C A
T G A G | | | | | G
G G A C G G A G G G C
G | | + T T
T A T G T
T G A G TGTGCGCGCAAGTGCACC
G + T
C - G
G - C
G - C
T - A
C A
T A
C G A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |