Sequence ID | >SRA1023079 |
Genome ID | SRR035083.516646 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001804) |
Species | |
Start position on genome | 38 |
End posion on genome | 111 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gttttgtcag |
tRNA gene sequence |
GCTGATGTAGCTCAGTCGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCATCGGTTCAAGT |
Downstream region at tRNA end position |
gtttttgggt |
Secondary structure (Cloverleaf model) | >SRA1023079 Thr GGT g TCag gtttttgggt G - C C - G T - A G - C A - T T - A G - C T G T T A G C C A T G A A | | | | | A C C T C G A T C G G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |