Sequence ID | >SRA1023101 |
Genome ID | SRR035083.519722 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001804) |
Species | |
Start position on genome | 211 |
End posion on genome | 293 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ttgcagtaag |
tRNA gene sequence |
GCCCGAGTGGTGGAATTGGTAGACACACTATCTTGAGGGGGTAGCGCCGCAAGGTGTAGG |
Downstream region at tRNA end position |
atactgatga |
Secondary structure (Cloverleaf model) | >SRA1023101 Leu GAG g ACtt atactgatga G - C C - G C - G C - G G - C A - T G - C T A T T C C T C A T A A G | | | | | G T G G T G A G G A G C G | | | T T G A C A C T A G A CGCCGCAAGGTGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |