| Sequence ID | >SRA1023151 |
| Genome ID | SRR035084.20887 |
| Phylum/Class | 454 Sequencing (SRP001805) |
| Species | |
| Start position on genome | 73 |
| End posion on genome | 150 |
| Amino Acid | Glu |
| Anticodon | TTC |
| Upstream region at tRNA start position |
ataacactat |
| tRNA gene sequence |
TGTCCGTTGGTGTAGCTGGCCCAACACGTCTCATTTTCGATGAGAAGATCATGGGTTCGA |
| Downstream region at tRNA end position |
gagctatttt |
| Secondary structure (Cloverleaf model) | >SRA1023151 Glu TTC
t ACCG gagctatttt
T - A
G + T
T - A
C - G
C - G
G - C
T - A T A
T T G C C C A
T C G A G | + | | | G
G T G T G A T G G G C
G | | | | T T
C A C A C
C C A G AGATC
T - A
C - G
T - A
C - G
A - T
T A
T G
T T C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |