| Sequence ID | >SRA1023196 |
| Genome ID | SRR035084.33659 |
| Phylum/Class | 454 Sequencing (SRP001805) |
| Species | |
| Start position on genome | 351 |
| End posion on genome | 276 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
gccctcatat |
| tRNA gene sequence |
CGCGGGATAGAGCAGTAGGTAGCTCGTCGGGCTCATAACCCGAAGGTCACAGGTTCGAGT |
| Downstream region at tRNA end position |
gtaaatagaa |
| Secondary structure (Cloverleaf model) | >SRA1023196 Met CAT
t ACTA gtaaatagaa
C T
G - C
C - G
G - C
G - C
G - C
A - T T G
T T G T C C A
T G A A | | | | | G
A C G A G A C A G G C
G | | | | T T
G G C T C
T A G AGGTC
T - A
C - G
G - C
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |