| Sequence ID | >SRA1023236 |
| Genome ID | SRR035084.46578 |
| Phylum/Class | 454 Sequencing (SRP001805) |
| Species | |
| Start position on genome | 119 |
| End posion on genome | 45 |
| Amino Acid | Cys |
| Anticodon | GCA |
| Upstream region at tRNA start position |
gagatgtgat |
| tRNA gene sequence |
GGCAACGTGGCGGAATGGTTACGCAGAGGATTGCAAATCCTTGTATCCCAGTTCGATTCT |
| Downstream region at tRNA end position |
Aaaaaaatct |
| Secondary structure (Cloverleaf model) | >SRA1023236 Cys GCA
t TACC Aaaaaaatct
G - C
G - C
C - G
A - T
A - T
C - G
G - C T T
T G G G T C A
A A G | | | | | G
T G G C G C C C A G C
G | | | T T
G A C G C
T T A GTAT
G + T
A - T
G - C
G - C
A - T
T A
T A
G C A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |