Sequence ID | >SRA1023475 |
Genome ID | SRR035084.106313 |
Search identical group | |
Phylum/Class | 454 Sequencing (SRP001805) |
Species | |
Start position on genome | 76 |
End posion on genome | 3 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
gagacaccaA |
tRNA gene sequence |
GTCGATATAGTCAAACGGTTATGATGTCACGCTTTCACCGTGAAGGTCGGGGTTCGATTC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1023475 Glu TTC A TTaa nnnnnnnnnn G + T T - A C - G G - C A - T T - A A - T T T T G C C C C A C A A A | | | | | G G A C T G C G G G G C G | | | + T T T T G A T T A G AGGT T - A C - G A - T C - G G - C C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |