| Sequence ID | >SRA1023493 |
| Genome ID | SRR035084.110642 |
| Phylum/Class | 454 Sequencing (SRP001805) |
| Species | |
| Start position on genome | 324 |
| End posion on genome | 398 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
cttgctcggc |
| tRNA gene sequence |
GGGCCTATAGCTCAGGTGGTTAGAGCGCTTCACTGATAATGAAGAGGTCGGAGGTTCAAG |
| Downstream region at tRNA end position |
tgagcacttt |
| Secondary structure (Cloverleaf model) | >SRA1023493 Ile GAT
c ACgg tgagcacttt
G - C
G - C
G - C
C - G
C - G
T - A
A - T T G
T C C T C C A
G G A A | | | | | A
T C T C G G G A G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
T - A
T - A
C - G
A - T
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |