| Sequence ID | >SRA1023662 |
| Genome ID | SRR035084.146309 |
| Phylum/Class | 454 Sequencing (SRP001805) |
| Species | |
| Start position on genome | 339 |
| End posion on genome | 266 |
| Amino Acid | Arg |
| Anticodon | CCT |
| Upstream region at tRNA start position |
tacggctgct |
| tRNA gene sequence |
GGCCCCGTAGCTCAGTGGATAGAGCAACGGTTTCCTAAACCGTGTGTCGGGTGTTCGATT |
| Downstream region at tRNA end position |
tttttagaaa |
| Secondary structure (Cloverleaf model) | >SRA1023662 Arg CCT
t ACtt tttttagaaa
G - C
G - C
C - G
C - G
C - G
C - G
G - C T T
T T C C A C A
T G A A + | | | | G
G C T C G G G G T G C
G | | | | T T
A G A G C
T A A GTGTC
A - T
C - G
G - C
G - C
T - A
T A
T A
C C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |