Sequence ID | >C151066478 |
Genome ID | CP010311 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Geoalkalibacter subterraneus Red1 [CP010311] |
Start position on genome | 1235291 |
End posion on genome | 1235365 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tgttttttat |
tRNA gene sequence |
TGGGGCGTCGCCAAGCGGTAAGGCATCGGATTTTGATTCCGACATACCCAGGTTCGAATC |
Downstream region at tRNA end position |
tttaaccaac |
Secondary structure (Cloverleaf model) | >C151066478 Gln TTG t GCCA tttaaccaac T - A G - C G - C G - C G - C C - G G - C T A T G G T C C A G A C | | | | | G C A C C G C C A G G C G | | | T T G A G G C T A A CATAC T - A C - G G - C G - C A - T T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |