Sequence ID | >C151066497 |
Genome ID | CP010311 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Geoalkalibacter subterraneus Red1 [CP010311] |
Start position on genome | 2976199 |
End posion on genome | 2976124 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
tctccgttgc |
tRNA gene sequence |
GAGCCGCTAGCTCAGTTGGTAGAGCATCTGACTTTTAATCAGATGGTCGAAGGTTCGAGT |
Downstream region at tRNA end position |
tttaagtccc |
Secondary structure (Cloverleaf model) | >C151066497 Lys TTT c ACCA tttaagtccc G - C A - T G - C C - G C - G G - C C - G T G T C T T C C A T G A A | | | | | G T C T C G G A A G G C G | | | | T T G G A G C T A A TGGTC T - A C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [Ensembl] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |